JosieN672521 JosieN672521

03-11-2022
Mathematics

contestada

In Triangle PQR, the measure of

Respuesta :

TrapperM212358 TrapperM212358

03-11-2022

As we can see we need to use a trigonometric function in order to find PQ

[tex]\cos (18)=\frac{PR}{96}[/tex]

we need to isolate the PR

[tex]PR=\cos (18)\cdot96=91.3[/tex]

PR=91.3ft

Answer Link

Otras preguntas

Whereas superficial flexors in the anterior compartment of the forearm originate from the _____ epicondyle of the humerus, the superficial extensors in the post

Which is closest to the value of w in the triangle below?

Why do presidential powers tend to grow during national emergencies?

what is 33/16 as a decimal rounded to the nearest hundredth.

Use a net to find the surface area of the cereal box.

Which of the following best describes how Esperanza and her friends 'try on a different reality' in their neighborhood? A. They talk to the girls in the neigh

Schutz (1958) advanced the notion of three basic interpersonal needs: ____________, control and affection. ____________ refers to the need to be with people and

The dance committee of Pine Bluff middle school earns $72 from a bake sale and will earn $4 for each ticket they sell to the Spring Fling dance.The dance will c

As he gazed, something bright and small seemed to twinkle down in the heart of it, vanished, then twinkled once more like a tiny star. But it could hardly be a

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA