rebecamichelle rebecamichelle

03-06-2021
English

contestada

PLS HELP!! Who comes to the party uninvited, but is pleasing to Clarissa?
a.
Sir Bradshaw
c.
Lady Bruton
b.
Dr. Holmes
d.
Sally Seton

Respuesta :

FizzyTheCat FizzyTheCat

03-06-2021

Answer:

Sally Seton

Explanation:

Answer Link

Otras preguntas

Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?

How do you find the length of the hypetnyuse if you have one angle and opposite side?

How many neutrons does element X have if its atomic number is 31 and its mass number is 90?

Jacqui has grades of 87 and 84. if she wants an average of 78 what does she have to score

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

The number of degrees of freedom for a test cross of an ss/rr individual would be