ianslatosch008 ianslatosch008

04-05-2021
Mathematics

contestada

Angles A and B are complementary. What is mB if mA = 15°? A. 75° B. 90° C. 105° D. 165°

Respuesta :

aliviamartin55599 aliviamartin55599

07-05-2021

Answer:

90

Step-by-step explanation:

Answer Link

ashleethecombatqueen ashleethecombatqueen

28-06-2021

Answer:

its 75 or A.

Step-by-step explanation:

Answer Link

Otras preguntas

Please help me with this

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

Find the length of the missing side of a right triangle if a=6 and c=11

The length of a rectangle is three times its width. If the perimeter of the rectangle is 40ft find it’s area

Why is the epa considered to be one of the most powerful bureaucracies?

What is let’s read a book in French

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved

Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo

(50)points 5 questions!