video4all video4all

04-03-2021
Biology

contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult

04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Find (x+4) (x²+x-2). Write your answer in standard form. The product is

Which best describes the law of conservation of mass? • The coefficients in front of the chemicals in the reactants should be based on the physical state of the

Hello I need Help with this question ASAP PLS.Question: The cost of 6 Apples is $1.20. What is the cost of 4 apples? State units of your answer.Pls Help me, I'm

Anti-Imperialist arguments included all of the following EXCEPT a, it went against the Declaration of Independence b. cost of maintaining the necessary militar

why is government action necessary to ensure the provision of public goods?

A gas station is 9 miles away. How far is the gas station in kilometers? Use the following conversion: 1 mile is 1.6 kilometers.

find the vaule of 3x + 2 when 7 +x =5

3. If all the producers in the above food web contain 40,000 Kcal of energy, how much energy will eventually be transferred to the Tertiary Consumer. a. 30,000

Determine whether each of the following sequences are arithmetic, geometric or neither. If arithmetic, state the common difference. If geometric, state the comm

Solve the system of equations.