video4all video4all

04-03-2021
Biology

contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult

04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

In one of the routine analyses, Dr Entropy found that the concentration of phosphate had increased from 0.0090 mg/L to 0.220 mg/L. This will require a lengthy

Involving the selection of rats from a cage. Assume that there are 6 rats in the cage: 3 trained and 3 untrained. A rat is removed from the cage and it is noted

How does it help a product to put a picture of it on a t-shirt?

Which of the following could be an example of a function with a domain(-infinity, infinity) and a range (-infinity, 4)? Check all that apply.A. y= - (3)^x - 4B.

How were the lives of many Chinese immigrants effected by the transcontinental railroad?

sciense question why are miscroscopes important in one paragrhaph

Marie et Sophie, vous venez du Canada. Vous blank blank

Find the x and y intercepts and then graph each line. Show work.

5. If an atom has 12 electrons, how many energy levels are occupied

name a value for x that will complete the inequality that is shown then explain why the value makes the inequality true 0.125 <x <9/50plz help explain it