video4all video4all

04-03-2021
Biology

contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult

04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Oxytocin ________. exerts its most important effects during menstruation is an anterior pituitary secretion controls milk production release is an example of a

Three electromagnetic waves arrive at a point from the same direction. They are polarized parallel to an x axis, and their electric fields at the point are E1 =

An individual’s blood-type alleles carry instructions that direct construction of a specific set of chemicals that protrude from every red blood cell. These che

Below is the justification for the formula for area of a circle. Which word, when placed in the blank best completes this argument?

Which phrase correctly completes this sentence? _________ mañana tú y yo podamos ir al museo juntos. A. Ojalá que B. Cree que C. Digo que D. Pienso que

What are the more appropriate measures of center and spread for this data set? 5 8 10 14 24

According to your textbook's treatment of Kohlberg's theory of moral development, a focus on rewards and punishment in respect to a moral dilemma is characteri

In regions where malaria is present, it acts as a selective agent that favors the heterozygous phenotype, because people with sickle-cell trait produce more of

Rearrange D=m/v to make v the variable

What are 3 reasons to support manifest destiny