video4all video4all

04-03-2021
Biology

contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult

04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

A chemical reaction is at equilibrium. Compared to the rate of the forward reaction, the rate of the reverse reaction is (1) faster and more reactant is produce

It takes 6 cubes to build a staircase with 3 steps . how many cubes will be need. For 11 steps

Simplify write equivalent expressions. 4-2+(3b+6)

How to research controversial history?

School A has 216 students and 12 classrooms. School B has 104 students and 4 classrooms. Part A: What is the ratio of students to classrooms at School A? Part B

In order for biological evolution to occur, the ______ of an organism must change and be passed on to offspring. blood DNA cells bone structure

A manager of a sporting goods store raises the price of a basketball from $16 to $18. What is the percent of increase?

Rosa put $750 into a savings account that earns 3% simple interest each year she plans to put no more money into this account how much money will be in the acco

British citizens in China were granted ____, or the right to live under their own laws.

Study the analogy, and then answer the question that follows. medium : average :: regular : normal What kind of analogy is this? A. synonyms B. part to whole C.