kwencygkrueger8 kwencygkrueger8

03-03-2021
Spanish

contestada

Which pronoun is used in the following
sentence?
(La gente comerá carne.)

Respuesta :

juniimarie juniimarie

03-03-2021

Answer:

her ?

Explanation:

a bit rusty but i believe it's the pronoun her !! or feminine pronouns ^^

Answer Link

mariepere17 mariepere17

03-03-2021

The people eat meat
Ans: the pronoun is “the”

Answer Link

Otras preguntas

First one that knows the answer wins brainliest

how do i know when to add or subtract in an angle equation?

A reaction was performed in which 3.4 g of benzoic acid was reacted with excess methanol to make 1.2 g of methyl benzoate. Calculate the theoretical yield and p

When Rome’s final ________ was overthrown, the Roman Republic began.

An equilateral triangle LMQ is drawn in the interior of square LMNP so that side LM is common. Find m LQP.

farmer ed has 3000 meters of fencing and wants to enclose a rectangle plot that borders on a river. if farmer ed does not fence the side along the river what is

Is The ozone layer is in better condition today than it was in the 1970s

Can someone help me with these problems I don’t understand them

The equivalent expression to 14d-9+21k-7dk+2.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template