heavenlyham7 heavenlyham7

04-02-2021
English

contestada

Is the boxed POSSESSIVE NOUN used correctly?
Do you know where the mens' room is?

Respuesta :

ohiogina70 ohiogina70

04-02-2021

Answer:

No, it is not used correctly. It should say "Do you know where the men's room is?"

Answer Link

Otras preguntas

What Are anti-federalist's viewpoints on ratifying the constitution?

Upload your blogprahy project about person born in another country. It must be at least 200 words long and be sure to include a list of sources you used (where

A felsic extrusive igneous rock is formed from silica-rich lava at Earth’s surface basaltic lava at Earth’s surface silica-rich magma within the Earth basaltic

Karlie Hastings is a writer (employee) for the Santa Fe Gazette and has an annual salary of $49,000. This year, she also realized net self-employment earnings o

OMS Manufacturing expects to produce and sell 12000 units of Big, its only product, for $20 each. Direct material cost is $3 per unit, direct labor cost is $10

A random sample of n = 16 professors from a university has been selected; salaries have been plotted on the following Q-Q plot. qqplot If we created a 95% confi

A rectangular box is going to be made with a volume of 274 cm3. The base of the box will be a square and the top will be open. The cost of the material for the

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

If an instrument measures in units of 0.5, then any value between which two values would be measured as 6?

what is the volume of a sphere with a radius of 6in.