KingSteve101 KingSteve101

01-02-2021
Mathematics

contestada

Can someone sub to my youttube channel pls, its called Yakobu, it would really help out :)

Can someone sub to my youttube channel pls its called Yakobu it would really help out class=

Respuesta :

sruzich7351 sruzich7351

01-02-2021

Answer:

yea sure

Step-by-step explanation:

Answer Link

roxannekoh26 roxannekoh26

01-02-2021

Answer:

yeah sure can you help me out with my points and star my answer helpful

Step-by-step explanation:

Answer Link

Otras preguntas

One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?

(60) Points HeLp asap 5 questions

What type of stock receives an equal part of the profits on each share to be distributed after all other obligations of a company have been satisfied? A.

There is no universally agreed-upon definition of cultural competence.

Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t

can you guys help me with this simple math problem ?

Describe these small intestine structures and their functions: intestinal glands -

Find the number. Six times a number is 9 more than three times the number. The number is |___| What I’m thinking right now “6x=27”