Edwarjl Edwarjl

04-05-2020
History

contestada

who was the Roman emperor that turned most of the city of Rome into marble ?

Respuesta :

ahoney3322 ahoney3322

07-05-2020

Answer:

Augustus

Explanation:

Answer Link

Otras preguntas

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Which of the following are true about the graph of y = (x - a)(x - b)2(x - c)3I) The graph travels through the point x = aII) The graph "bounces off" the point

Which inequality has the solution shown below? H - 18 -17 -16 -15 -14 -13 -12 0.42 +7 3 0.36 +8

A hydraulic jack has an input cylinder diameter of 3.2 in and an output cylinder diameter of 9.2 in. an input force of 485 lb is observed to produce an output f

Find the following for path C in the figure below (a) the total distance traveledm(b) the distance from start to finishm(c) the displacement from start to finis

Question 5 of 10 How does the rate law show how concentration changes affect the rate of reaction? O A. The rate is expressed in terms of concentrations of the

using demos find the line of best fit to compare fat (x) and the calories(y) from the table pictured. round to the nearest hundredth (2 decimal places if neede

compare a=0.432, b=0.437

Find all missing parts of the triangle. When necessary, round answers to the nearest tenth. ONLY enter the answer, not units ordegree symbols.B28САB (angle B)=a

The landscaper pours 200 gallons of herbicide in a pond. The herbicide degrades 11% each week.Write an equation to find the amount of herbicide in any given wee