xxxtentacionfans20 xxxtentacionfans20

02-04-2020
History

contestada

why did Saul hate the followers of Jesus

Respuesta :

rachelkim999 rachelkim999

02-04-2020

He believed the teaching of Jesus violated Mosaic Law another term for Law of Moses.

Answer Link

Otras preguntas

Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1

How did the cold war shape american culture in the late 1950s and 1960s? what was the most important impact?

Renaissance painters in flanders as in italy tended to produce work that was

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Ully is having a party and wants to fill his swimming pool. if he only uses his hose it takes 2 hours more than if he only uses his neighbor's house. of houses

Find the length of the missing side of a right triangle if a=6 and c=11

Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile