J1an5eshaylchie J1an5eshaylchie

01-06-2016
Biology

contestada

Carbon monoxide can affects the body by preventing the hemoglobin in red blood cells from up taking carbon dioxide.

True
False

Respuesta :

JacobLeviste JacobLeviste

06-06-2016

False it prevents red blood cells from taking up Oxygen not carbon dioxide

Answer Link

michaelanikk michaelanikk

03-02-2019

The answer is false.

When carbon monoxide gets into a persons bloodstream, it does not allow the blood to carry oxygen & as a result it slowly suffocates the person.

Answer Link

Otras preguntas

The diluted ink used with a brush to create various tones or values is called a _______ (blank).

For reproducibility needed for auto-grading, seed the program with a value of 2. In a real program, you would seed with the current time. In that case, every pr

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A downtown bank is advertising that if you deposit $1,000 with them, and leave it there for 65 months, you can get $2,000 back at the end of the period. Assumin

Iron Works, Inc. purchased a metal casting machine on January 1, 2014. The cost of the machine was $32,000. Its estimated residual value was $7,000 at the end o

Write a do-while loop that continues to prompt a user to enter a number less than 100, until the entered number is actually less than 100. End each prompt with

which ion is typically present in soil with a high acidity

Although the southern states were all seated in Congress by 1870, federal troops remained in some southern states until the compromise of 1877. * true or false

Simplify: –3(y + 2)^2 – 5 + 6y

Josie uses 7.3 pints of white paint and blue paint to paint her bedroom walls. 3 4 of this amount is white paint, and the rest is blue paint. How many pints of